Résumé
Abstract only Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (5). In the Federal Democratic Republic of Ethiopia, however, the disease has never been reported in rice fields. In September 2012, plants with leaf yellowing and mottling symptoms were observed near Bahir Dar and in the Fogera district in the northwestern part of the country during a joint survey of scientists from Madagascar (FOFIFA), Ethiopian Institute of Agricultural Research (EIAR), and Japan International Cooperation Agency (JICA). The disease was observed in 2013 in Fogera and Dera districts, where samples were collected, causing small patches of infected plants in ~5% of the fields. Symptomatic leaves of two plants collected in the fields were inoculated on five plants of the susceptible O. sativa cultivar IR64. All inoculated plants reproduced the typical yellow mottle symptoms. Symptomatic leaves of eight plants collected in the fields reacted positively when tested by double antibody sandwich (DAS)-ELISA tests with a polyclonal antiserum raised against a Madagascan isolate of RYMV (2), indicating for the first time the presence of the virus in Ethiopia. Triple antibody sandwich (TAS) tests with discriminant monoclonal antibodies (2) revealed that they all belonged to serotype 4, a serotype found in East Africa and in Madagascar. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from four samples. The 720-bp coat protein (CP) gene was amplified with reverse transcription (RT)-PCR with the primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (3). The sequences were deposited in GenBank (Accession Nos. KMO17554, KMO14555, KMO17556, and KMO17557). The four sequences showed over 98% nucleotide identity between each other. They shared over 92% nucleotide identity with isolates of strains S4 found in Kenya, Uganda, Tanzania, and Madagascar (4). Agricultural changes associated to rice intensification are known to favor RYMV emergence and spread (5). Recent efforts have been led by the National Rice Research and Development Strategy (NRRDSE) to intensify rice cultivation in Ethiopia (1). Early knowledge of RYMV occurrence in the country is a prerequisite to extended surveys of the disease and implementation of control measures. References: (1) K. Assefa et al. Challenges and opportunities of rice in Ethiopian agricultural development. www.eiar.gov.et/Publications/frgseries2.pdf , 2011. (2) D. Fargette et al. Arch. Virol. 147:583, 2002. (3) A. Pinel et al. Arch. Virol. 145:1621, 2000. (4) M. Rakotomalala et al. Virus Res. 171:71, 2013. (5) O. Traoré et al. Virus Res. 141:258, 2009.