Logo image
Retour
TABLE 1 in A new species of planthopper in the genus Eumyndus (Hemiptera: Cixiidae) from palms in eastern Madagascar and molecular evidence for the synonymy of Eumyndus kraussi and Eumyndus metcalfi
Jeu de données

TABLE 1 in A new species of planthopper in the genus Eumyndus (Hemiptera: Cixiidae) from palms in eastern Madagascar and molecular evidence for the synonymy of Eumyndus kraussi and Eumyndus metcalfi

Brian W. Bahder, Safidinirina Armande Randretsiferana, Andrianatenaina Randretsiferana, Adam Stroiński, Piotr Łukasik, Charles R. Bartlett, Fabian Pilet et Rasolondalao Harin'Hala Hasinjaka
Zenodo
30/09/2024
DOI: https://doi.org/10.5281/zenodo.13937246

Résumé

Biodiversity Taxonomy
TABLE 1. Primers used to amplify loci used for assessment of Eumyndus jeanjacquei sp. nov. and corresponding annealing temperatures and extension times. Gene Primer NameSequence (5’→3’)Annealing ExtensionReferenceCOI LCO1490 HCO2198GGTCAACAAATCATAAAGATATTG TCAGGGTGACCAAAAAAATCA40˚C1 min. 30 sec. Folmer et al. 199418S 18SFI 18SRIACTGTCGATGGTAGGTTCTG GTCCGAAGACCTCACTAAA50˚C2 min.Bahder et al. 201928S V XGTAGCCAAATGCCTCGTCA CACAATGATAGGAAGAGCC55˚C1 min. 30 sec. Cryan et al. 2000

Indicateurs

1 Consultations de la notice

Détails

Logo image